Review



scrambled shrna sequence tagged with gfp shnc  (Genechem)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Genechem scrambled shrna sequence tagged with gfp shnc
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Scrambled Shrna Sequence Tagged With Gfp Shnc, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scrambled+shrna+sequence+tagged+with+gfp+shnc/scrambled+shrna+sequence+tagged+with+gfp+shnc/pmc12219463-64-37-47
    Average 90 stars, based on 1 article reviews
    scrambled shrna sequence tagged with gfp shnc - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "MS 275 Inhibits Neuroblastoma Cell Growth by Mediating H 3 K 27ac/ PROX 1 Axis In Silico and In Vitro"

    Article Title: MS 275 Inhibits Neuroblastoma Cell Growth by Mediating H 3 K 27ac/ PROX 1 Axis In Silico and In Vitro

    Journal: The FASEB Journal

    doi: 10.1096/fj.202500464RR

    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Figure Legend Snippet: PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.

    Techniques Used: Stable Transfection, Cell Culture, Flow Cytometry, Staining



    Similar Products

    scrambled shrna sequence tagged with gfp shnc  (Genechem)
    90
    Genechem scrambled shrna sequence tagged with gfp shnc
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Scrambled Shrna Sequence Tagged With Gfp Shnc, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scrambled+shrna+sequence+tagged+with+gfp+shnc/scrambled+shrna+sequence+tagged+with+gfp+shnc/pmc12219463-64-37-47
    Average 90 stars, based on 1 article reviews
    scrambled shrna sequence tagged with gfp shnc - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.

    Journal: The FASEB Journal

    Article Title: MS 275 Inhibits Neuroblastoma Cell Growth by Mediating H 3 K 27ac/ PROX 1 Axis In Silico and In Vitro

    doi: 10.1096/fj.202500464RR

    Figure Lengend Snippet: PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.

    Article Snippet: For the lentivirus‐mediated RNA interference targeting PROX1expression, three specific short hairpin RNAs (shRNAs) against PROX1, namely, shPROX1‐3 (target sequence: GCTCTGAACATGCACTACAAT), shPROX1‐4 (target sequence: CCGACGTAAAGTTCAACAGAT), and shPROX1‐5 (target sequence: CCCGAGAAAGTTACAGAGAAA) along with a scrambled shRNA sequence tagged with GFP, serving as a negative control (shNC), were purchased from Genechem (Shanghai, China).

    Techniques: Stable Transfection, Cell Culture, Flow Cytometry, Staining